Regulon of MalR in Streptococcus gordonii str. Challis substr. CH1

Properties
Regulator type:	Transcription factor
TF locus tag:	SGO_0100
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Streptococcaceae
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 80 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.7 Sequence: TTATGAAAACGTTTGCTTTA Locus tag: SGO_1351 Name: nepU Funciton: Neopullulanase (EC 3.2.1.135)
	SGO_1351	nepU	Neopullulanase (EC 3.2.1.135)
Position: -105 Score: 5.2 Sequence: CGACGCAAACGTTTGCGTCC Locus tag: SGO_1075 Name: amyA2 Funciton: Cytoplasmic alpha-amylase (EC 3.2.1.1)
	SGO_1075	amyA2	Cytoplasmic alpha-amylase (EC 3.2.1.1)
Position: -280 Score: 5.5 Sequence: CAACGAAAACGTTTGCGTAG Position: -66 Score: 6 Sequence: TTAAGAAAACGTTTGCGTAA Locus tag: SGO_0104 Name: malX Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: SGO_0103 Name: malC Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: SGO_0102 Name: malD Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: SGO_0101 Name: malA Funciton: Maltodextrose utilization protein MalA Locus tag: SGO_0100 Name: malR Funciton: Maltose utilization transcriptional regulator MalR, LacI family
	SGO_0104	malX	Maltose/maltodextrin ABC transporter, substrate-binding protein
	SGO_0103	malC	Maltose/maltodextrin ABC transporter, permease protein 1
	SGO_0102	malD	Maltose/maltodextrin ABC transporter, permease protein 2
	SGO_0101	malA	Maltodextrose utilization protein MalA
	SGO_0100	malR	Maltose utilization transcriptional regulator MalR, LacI family
Position: -278 Score: 5.7 Sequence: TTACGCAAACGTTTTCTTAA Position: -64 Score: 5.4 Sequence: CTACGCAAACGTTTTCGTTG Locus tag: SGO_0105 Name: malM Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: SGO_0106 Name: malP Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
	SGO_0105	malM	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	SGO_0106	malP	Maltodextrin phosphorylase (EC 2.4.1.1)
Position: -290 Score: 5.3 Sequence: TCACGCAATCGTTTGCTTAA Position: -49 Score: 5.6 Sequence: CAATGCAAACGATTTCATAT Locus tag: SGO_0505 Name: ptsG Funciton: PTS system glucose-specific EIICBA component (EC 2.7.1.69) Locus tag: SGO_0506 Name: rgfB Funciton: Exodeoxyribonuclease III (EC 3.1.11.2)
	SGO_0505	ptsG	PTS system glucose-specific EIICBA component (EC 2.7.1.69)
	SGO_0506	rgfB	Exodeoxyribonuclease III (EC 3.1.11.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD