Regulon of MalR in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type:	Transcription factor
TF locus tag:	L0144
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 80 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -187 Score: 5.5 Sequence: TGTCGCAAACGGTTGCGTCA Locus tag: L128694 Name: nepU Funciton: Neopullulanase (EC 3.2.1.135)
	L128694	nepU	Neopullulanase (EC 3.2.1.135)
Position: -68 Score: 5.6 Sequence: AAAAGCAAACGGTTGTGTAA Locus tag: L128695 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: L128696 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: L128697 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
	L128695	malE	Maltose/maltodextrin ABC transporter, substrate-binding protein
	L128696	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	L128697	malG	Maltose/maltodextrin ABC transporter, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD