Regulon of MalR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type:	Transcription factor
TF locus tag:	LACR_1846
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 80 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -191 Score: 5.7 Sequence: ATTCGCAAACGGTTGCGTCA Locus tag: LACR_1852 Name: nepU Funciton: Neopullulanase (EC 3.2.1.135)
	LACR_1852	nepU	Neopullulanase (EC 3.2.1.135)
Position: -68 Score: 6.1 Sequence: AAAAGCAAACGGTTGCGTAA Locus tag: LACR_1853 Name: malE Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: LACR_1854 Name: malF Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: LACR_1855 Name: malG Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
	LACR_1853	malE	Maltose/maltodextrin ABC transporter, substrate-binding protein
	LACR_1854	malF	Maltose/maltodextrin ABC transporter, permease protein 1
	LACR_1855	malG	Maltose/maltodextrin ABC transporter, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD