Regulon of PhnR in Acinetobacter baumannii AB0057

Properties
Regulator type:	Transcription factor
TF locus tag:	AB57_1567
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Moraxellaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - PhnR
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 6.4 Sequence: AATCTGGTTTAAACCAGATT Locus tag: AB57_1568 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: AB57_1569 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: AB57_1570 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
	AB57_1568	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	AB57_1569	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	AB57_1570	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Position: -21 Score: 6.3 Sequence: CATCTGGTTTAAACCAGATT Locus tag: AB57_1572 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: AB57_1573 Name: phnX Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	AB57_1572	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	AB57_1573	phnX	Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD