Regulog PhnR - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization; 2-aminoethylphosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - PhnR
- By TF family - GntR/Others
- By pathway - Phosphonate utilization
- By pathway - 2-aminoethylphosphonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | ||
| Acinetobacter baumannii AB0057 | 5 | 2 |
| Psychrobacter arcticum 273-4 | ||
| Psychrobacter sp. PRwf-1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| phnW |
|
*
Acinetobacter baumannii AB0057 Site: position = -21 score = 6.25144 sequence = CATCTGGTTTAAACCAGATT Gene: AB57_1572: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
|
|
2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
| phnX |
|
Gene: AB57_1573: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
|
|
Phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
| CRON 2. | |||||
| phnS |
|
*
Acinetobacter baumannii AB0057 Site: position = -85 score = 6.43105 sequence = AATCTGGTTTAAACCAGATT Gene: AB57_1568: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
|
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
| phnT |
|
Gene: AB57_1569: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
|
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
| phnU |
|
Gene: AB57_1570: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
|
|
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |