Regulon of PhnR in Hahella chejuensis KCTC 2396

Properties
Regulator type:	Transcription factor
TF locus tag:	HCH_00465, HCH_03089
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - PhnR
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -275 Score: 5 Sequence: AATCTGGTTCGTACCAGTAG Position: -196 Score: 4.6 Sequence: ATCTTGGTCCGAACCAGATG Locus tag: HCH_00466 Name: COG1409 Funciton: Predicted phosphohydrolase
	HCH_00466	COG1409	Predicted phosphohydrolase
Position: -188 Score: 4.9 Sequence: CATCTGGTTCGGACCAAGAT Position: -109 Score: 4.9 Sequence: CTACTGGTACGAACCAGATT Locus tag: HCH_00465 Name: phnR1 Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
	HCH_00465	phnR1	2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Position: -28 Score: 5.4 Sequence: TTTTTGGAATAGACCAGAAG Locus tag: HCH_03089 Name: phnR2 Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
	HCH_03089	phnR2	2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Position: -51 Score: 6.3 Sequence: CTTCTGGTATAGACCAGAAG Locus tag: HCH_03088 Name: phnS2 Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component
	HCH_03088	phnS2	2-aminoethylphosphonate ABC transporter, periplasmic binding component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD