Regulog PhnR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization; 2-aminoethylphosphonate utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - PhnR
- By TF family - GntR/Others
- By pathway - Phosphonate utilization
- By pathway - 2-aminoethylphosphonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | 4 | 4 |
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Marinomonas sp. MWYL1 | ||
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | ||
| Chromohalobacter salexigens DSM 3043 | ||
| Reinekea sp. MED297 | ||
| Alcanivorax borkumensis SK2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| phnS2 |
*
Hahella chejuensis KCTC 2396 Site: position = -51 score = 6.27767 sequence = CTTCTGGTATAGACCAGAAG Gene: HCH_03088: 2-aminoethylphosphonate ABC transporter, periplasmic binding component |
|
|
|
|
|
|
|
|
|
|
|
2-aminoethylphosphonate ABC transporter, periplasmic binding component |
| CRON 2. | |||||||||||||
| phnR2 |
*
Hahella chejuensis KCTC 2396 Site: position = -28 score = 5.35496 sequence = TTTTTGGAATAGACCAGAAG Gene: HCH_03089: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
|
|
|
|
|
|
|
|
|
|
|
2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
| CRON 3. | |||||||||||||
| COG1409 |
*
Hahella chejuensis KCTC 2396 Site: position = -275 score = 5.039 sequence = AATCTGGTTCGTACCAGTAG Site: position = -196 score = 4.56368 sequence = ATCTTGGTCCGAACCAGATG Gene: HCH_00466: Predicted phosphohydrolase |
|
|
|
|
|
|
|
|
|
|
|
Predicted phosphohydrolase |
| CRON 4. | |||||||||||||
| phnR1 |
*
Hahella chejuensis KCTC 2396 Site: position = -188 score = 4.8586 sequence = CATCTGGTTCGGACCAAGAT Site: position = -109 score = 4.92485 sequence = CTACTGGTACGAACCAGATT Gene: HCH_00465: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
|
|
|
|
|
|
|
|
|
|
|
2-aminoethylphosphonate uptake and metabolism regulator, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |