Regulon of PhnF in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_2856
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Regulog:	PhnF - Rhodobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - PhnF
By TF family - GntR/Others
By pathway - Phosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 5.3 Sequence: TTGTCCATTTAATTATACAA Locus tag: Jann_2856 Name: phnF Funciton: Transcriptional regulator for phosphonate utilization, GntR family
	Jann_2856	phnF	Transcriptional regulator for phosphonate utilization, GntR family
Position: -29 Score: 5.3 Sequence: TTGTATAATTAAATGGACAA Locus tag: Jann_2855 Name: phnN Funciton: Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)
	Jann_2855	phnN	Ribose 1,5-bisphosphokinase activity (phosphoribosyl diphosphate forming)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD