Regulon of RutR in Ralstonia eutropha JMP134

Properties
Regulator type:	Transcription factor
TF locus tag:	Reut_B3988
Regulator family:	TetR
Regulation mode:	repressor (activator)
Biological process:	Pyrimidine utilization
Effector:	Uracil
Regulog:	RutR - Ralstonia
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - RutR
By taxonomy - Ralstonia
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 7.1 Sequence: ACTTGACCATTTGGTCAGGA Locus tag: Reut_B3985 Name: ribA2 Funciton: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog Locus tag: Reut_B3986 Name: PF07958 Funciton: Conserved hypothetical protein Locus tag: Reut_B3987 Name: upp Funciton: Uracil phosphoribosyltransferase (EC 2.4.2.9) Locus tag: Reut_B3988 Name: rutR Funciton: Transcriptional regulator, TetR family Locus tag: Reut_B3989 Name: ppuB Funciton: Predicted ABC transporter, substrate-binding protein precursor Locus tag: Reut_B3990 Name: ppuA Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: Reut_B3991 Name: ppuC Funciton: Predicted ABC transporter, permease protein Locus tag: Reut_B3992 Name: ppuD Funciton: Predicted ABC transporter, inner membrane protein precursor Locus tag: Reut_B3993 Name: codA Funciton: Cytosine deaminase (EC 3.5.4.1)
	Reut_B3985	ribA2	GTP cyclohydrolase II (EC 3.5.4.25 ) homolog
	Reut_B3986	PF07958	Conserved hypothetical protein
	Reut_B3987	upp	Uracil phosphoribosyltransferase (EC 2.4.2.9)
	Reut_B3988	rutR	Transcriptional regulator, TetR family
	Reut_B3989	ppuB	Predicted ABC transporter, substrate-binding protein precursor
	Reut_B3990	ppuA	Predicted ABC transporter, ATP-binding protein
	Reut_B3991	ppuC	Predicted ABC transporter, permease protein
	Reut_B3992	ppuD	Predicted ABC transporter, inner membrane protein precursor
	Reut_B3993	codA	Cytosine deaminase (EC 3.5.4.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD