Regulon of PsrA in Bradyrhizobium sp. BTAi1

Properties
Regulator type:	Transcription factor
TF locus tag:	BBta_5106
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Rhizobiales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - PsrA
By taxonomy - Rhizobiales
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 5.9 Sequence: TCTCAAACAATAGTTTCATA Position: -41 Score: 6.4 Sequence: TTTCATACAATTGTTTGAAA Locus tag: BBta_5106 Name: psrA Funciton: Transcriptional regulator for fatty acid degradation PsrA, TetR family
	BBta_5106	psrA	Transcriptional regulator for fatty acid degradation PsrA, TetR family
Position: -192 Score: 6.4 Sequence: TTTCAAACAATTGTATGAAA Position: -179 Score: 5.9 Sequence: TATGAAACTATTGTTTGAGA Locus tag: BBta_5105 Name: acdH Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3)
	BBta_5105	acdH	Acyl-CoA dehydrogenase (EC 1.3.99.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD