Regulon of PsrA in Rhodopseudomonas palustris CGA009

Properties
Regulator type:	Transcription factor
TF locus tag:	RPA3290
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Rhizobiales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - PsrA
By taxonomy - Rhizobiales
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 5.6 Sequence: TGTGAAACGATAGTTTCATA Position: -50 Score: 5.8 Sequence: TTTCATACAGCTGTTTGAAT Locus tag: RPA3290 Name: psrA Funciton: Transcriptional regulator for fatty acid degradation PsrA, TetR family
	RPA3290	psrA	Transcriptional regulator for fatty acid degradation PsrA, TetR family
Position: -214 Score: 5.8 Sequence: ATTCAAACAGCTGTATGAAA Position: -201 Score: 5.6 Sequence: TATGAAACTATCGTTTCACA Locus tag: RPA3289 Name: acdH Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3)
	RPA3289	acdH	Acyl-CoA dehydrogenase (EC 1.3.99.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD