Regulon of PsrA in Laribacter hongkongensis HLHK9

Properties
Regulator type:	Transcription factor
TF locus tag:	LHK_01607
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Various betaproteobacteria
Statistics of regulated genes:
- Genes	16
- Operons	12
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - PsrA
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -187 Score: 6.1 Sequence: ATTCAAACGACTGTTTGAAG Locus tag: LHK_02913 Name: etfB Funciton: Electron transfer flavoprotein, beta subunit Locus tag: LHK_02912 Name: etfA Funciton: Electron transfer flavoprotein, alpha subunit Locus tag: LHK_02910 Name: acdH2 Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3)
	LHK_02913	etfB	Electron transfer flavoprotein, beta subunit
	LHK_02912	etfA	Electron transfer flavoprotein, alpha subunit
	LHK_02910	acdH2	Acyl-CoA dehydrogenase (EC 1.3.99.3)
Position: -88 Score: 5.8 Sequence: GTTCAAACGATCGTTTTATT Locus tag: LHK_02384 Name: null Funciton: probable acyl-CoA-binding protein
	LHK_02384		probable acyl-CoA-binding protein
Position: -54 Score: 6 Sequence: ATCCAAACATTCGTTTGAAA Position: -21 Score: 5.5 Sequence: TTTCAAACGGTCGTTTAACC Locus tag: LHK_02264 Name: acdH Funciton: Probable acyl-CoA dehydrogenase
	LHK_02264	acdH	Probable acyl-CoA dehydrogenase
Position: -90 Score: 5.4 Sequence: AGGCAAACGCCCGTTTGACA Locus tag: LHK_00568 Name: fabF Funciton: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
	LHK_00568	fabF	3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
Position: -40 Score: 5.8 Sequence: TATCAAACACTCGTTTGATA Locus tag: LHK_02406 Name: scp Funciton: SCP-2 sterol transfer family
	LHK_02406	scp	SCP-2 sterol transfer family
Position: 43 Score: 6 Sequence: AATCAAACGGTCGTTTGACA Locus tag: LHK_00049 Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
	LHK_00049	fadH	2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
Position: -68 Score: 5.9 Sequence: ATTCAAACAGTCGTTTGATG Locus tag: LHK_00066 Name: null Funciton: Putative enoyl-CoA hydratase
	LHK_00066		Putative enoyl-CoA hydratase
Position: -107 Score: 5.6 Sequence: AATCAAACGACCGTTTGGCT Locus tag: LHK_01931 Name: fadD Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
	LHK_01931	fadD	Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Position: -22 Score: 5.6 Sequence: TTTCAAACGATCGTTTGCTT Locus tag: LHK_02202 Name: null Funciton: hypothetical protein
	LHK_02202		hypothetical protein
Position: -142 Score: 5.6 Sequence: TATAAAACGGCTGTTTGAAA Position: -63 Score: 4.9 Sequence: TCTCAAACGATCGTTTGCCT Locus tag: LHK_01608 Name: fadL Funciton: Long-chain fatty acid transport protein Locus tag: LHK_01609 Name: acdB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) Locus tag: LHK_01610 Name: acdA Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
	LHK_01608	fadL	Long-chain fatty acid transport protein
	LHK_01609	acdB	Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
	LHK_01610	acdA	3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Position: -38 Score: 5.4 Sequence: ATTAAAACGTAAGTTTCAAA Position: -25 Score: 5.6 Sequence: TTTCAAACAACTGTTTGGAT Locus tag: LHK_01607 Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
	LHK_01607	psrA	Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Position: -97 Score: 5.9 Sequence: ATTCAAACGGCCGTTTGACG Locus tag: LHK_02892 Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
	LHK_02892	etfD	Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PsrA in Laribacter hongkongensis HLHK9

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --