Regulon of ModE2 in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_0650
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Regulog:	ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdenum
By pathway - Molybdopterin biosynthesis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -179 Score: 4.7 Sequence: ATTCTGTCAGGATAGGCATATA Locus tag: DvMF_2533 Name: null Funciton: formate dehydrogenase alpha subunit Locus tag: DvMF_2534 Name: null Funciton: formate dehydrogenase, beta subunit
	DvMF_2533		formate dehydrogenase alpha subunit
	DvMF_2534		formate dehydrogenase, beta subunit
Position: -331 Score: 5.2 Sequence: ATTATGCTTTTTCAGACATATG Locus tag: DvMF_0321 Name: null Funciton: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
	DvMF_0321		Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Position: -310 Score: 4.7 Sequence: AATGTGTCACCATTGACATAGT Position: -258 Score: 4.6 Sequence: CCTATGTCATGCAAGGCATAAA Locus tag: DvMF_1956 Name: null Funciton: putative tungsten-containing aldehyde ferredoxin oxidoreductase
	DvMF_1956		putative tungsten-containing aldehyde ferredoxin oxidoreductase
Position: -216 Score: 5.1 Sequence: CATATGTCTGAAAAAGCATAAT Locus tag: DvMF_0320 Name: phsA Funciton: molybdopterin oxidoreductase Locus tag: DvMF_0319 Name: null Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
	DvMF_0320	phsA	molybdopterin oxidoreductase
	DvMF_0319		4Fe-4S ferredoxin iron-sulfur binding domain protein
Position: -143 Score: 4.3 Sequence: ATTATGTCATTATGAGCAGGTA Locus tag: DvMF_0650 Name: null Funciton: Transcriptional regulator, ModE family
	DvMF_0650		Transcriptional regulator, ModE family
Position: -227 Score: 4.5 Sequence: GTTCTGTTTTTTTCAACATGTT Locus tag: DvMF_2780 Name: null Funciton: ABC-type tungstate transport system, periplasmic binding protein Locus tag: DvMF_2781 Name: null Funciton: ABC-type tungstate transport system, permease protein Locus tag: DvMF_2782 Name: null Funciton: ABC-type tungstate transport system, ATP-binding protein
	DvMF_2780		ABC-type tungstate transport system, periplasmic binding protein
	DvMF_2781		ABC-type tungstate transport system, permease protein
	DvMF_2782		ABC-type tungstate transport system, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD