Regulon of ModE2 in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU1561, DVU1759
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Regulog:	ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdenum
By pathway - Molybdopterin biosynthesis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 4.3 Sequence: GTTATGCAAGTCTGTGCATAAG Locus tag: DVU1560 Name: null Funciton: molybdopterin binding domain protein Locus tag: DVU1559 Name: mop Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
	DVU1560		molybdopterin binding domain protein
	DVU1559	mop	aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
Position: -332 Score: 4.8 Sequence: TCTATGTTTTTTCTGGCATATG Locus tag: DVU2405 Name: null Funciton: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
	DVU2405		Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
Position: -170 Score: 4.6 Sequence: TGTGTGTTAATTGTAACATATT Locus tag: DVU0586 Name: null Funciton: hypothetical protein Locus tag: DVU0587 Name: fdnG-1 Funciton: formate dehydrogenase, alpha subunit Locus tag: DVU0588 Name: hybA Funciton: formate dehydrogenase, beta subunit
	DVU0586		hypothetical protein
	DVU0587	fdnG-1	formate dehydrogenase, alpha subunit
	DVU0588	hybA	formate dehydrogenase, beta subunit
Position: -333 Score: 4.2 Sequence: TATATGTTTTATTTAACCTACT Locus tag: DVU2812 Name: fdnG-3 Funciton: formate dehydrogenase, alpha subunit Locus tag: DVU2811 Name: null Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2) Locus tag: DVU2810 Name: null Funciton: formate dehydrogenase formation protein FdhE, putative Locus tag: DVU2809 Name: null Funciton: cytochrome c3
	DVU2812	fdnG-3	formate dehydrogenase, alpha subunit
	DVU2811		Formate dehydrogenase O beta subunit (EC 1.2.1.2)
	DVU2810		formate dehydrogenase formation protein FdhE, putative
	DVU2809		cytochrome c3

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD