Regulon of ModE2 in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type:	Transcription factor
TF locus tag:	Dbac_1565, Dbac_0983
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Regulog:	ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	12
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdenum
By pathway - Molybdopterin biosynthesis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -76 Score: 4.4 Sequence: TTTCTGTCTTTGTTGACTTAAA Locus tag: Dbac_2354 Name: wtpA Funciton: ABC-type tungstate/molybdate transport system, periplasmic component
	Dbac_2354	wtpA	ABC-type tungstate/molybdate transport system, periplasmic component
Position: -227 Score: 5 Sequence: ATGATGCCAAACAAGGCATAAT Locus tag: Dbac_1566 Name: null Funciton: Formylmethanofuran dehydrogenase subunit E Locus tag: Dbac_1565 Name: null Funciton: Transcriptional regulator, ModE family
	Dbac_1566		Formylmethanofuran dehydrogenase subunit E
	Dbac_1565		Transcriptional regulator, ModE family
Position: -120 Score: 4.9 Sequence: GTTATGTCACCCATGACATATG Locus tag: Dbac_2970 Name: null Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
	Dbac_2970		Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
Position: -125 Score: 4.8 Sequence: TATGTATTATTTATAACATATT Locus tag: Dbac_1570 Name: null Funciton: formate dehydrogenase, alpha subunit Locus tag: Dbac_1569 Name: null Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2) Locus tag: Dbac_1568 Name: null Funciton: formate dehydrogenase formation protein FdhE, putative
	Dbac_1570		formate dehydrogenase, alpha subunit
	Dbac_1569		Formate dehydrogenase O beta subunit (EC 1.2.1.2)
	Dbac_1568		formate dehydrogenase formation protein FdhE, putative
Position: -192 Score: 5 Sequence: GTTATGCCTTTCCGGGCATATT Position: -63 Score: 5.4 Sequence: GATATGTCAATATTGACATGTT Locus tag: Dbac_1563 Name: null Funciton: molybdopterin binding domain protein Locus tag: Dbac_1562 Name: null Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
	Dbac_1563		molybdopterin binding domain protein
	Dbac_1562		aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
Position: -62 Score: 5 Sequence: CTTGTGTCTGATTTGGCATATG Position: -32 Score: 4.4 Sequence: CGTATGTCATTTTTCACTTAAC Locus tag: Dbac_3402 Name: null Funciton: ABC-type tungstate transport system, periplasmic binding protein Locus tag: Dbac_3403 Name: null Funciton: ABC-type tungstate transport system, permease protein Locus tag: Dbac_3404 Name: null Funciton: ABC-type tungstate transport system, ATP-binding protein
	Dbac_3402		ABC-type tungstate transport system, periplasmic binding protein
	Dbac_3403		ABC-type tungstate transport system, permease protein
	Dbac_3404		ABC-type tungstate transport system, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD