Regulon of ModE2 in Desulfohalobium retbaense DSM 5692

Properties
Regulator type:	Transcription factor
TF locus tag:	Dret_2172
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Regulog:	ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdenum
By pathway - Molybdopterin biosynthesis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -10 Score: 5 Sequence: GTTATGTTTTATGAGGCATAAC Locus tag: Dret_0225 Name: null Funciton: hypothetical protein Locus tag: Dret_0226 Name: null Funciton: formate dehydrogenase, alpha subunit Locus tag: Dret_0227 Name: null Funciton: formate dehydrogenase, beta subunit
	Dret_0225		hypothetical protein
	Dret_0226		formate dehydrogenase, alpha subunit
	Dret_0227		formate dehydrogenase, beta subunit
Position: -32 Score: 4.4 Sequence: TATATGTCTTTTTTAGCAAAGG Locus tag: Dret_0525 Name: wtpA Funciton: ABC-type tungstate/molybdate transport system, periplasmic component Locus tag: Dret_0526 Name: wtpB Funciton: ABC-type tungstate/molybdate transport system, permease protein Locus tag: Dret_0527 Name: wtpC Funciton: ABC-type tungstate/molybdate transport system, ATP-binding component
	Dret_0525	wtpA	ABC-type tungstate/molybdate transport system, periplasmic component
	Dret_0526	wtpB	ABC-type tungstate/molybdate transport system, permease protein
	Dret_0527	wtpC	ABC-type tungstate/molybdate transport system, ATP-binding component
Position: -166 Score: 4.6 Sequence: GCTATGCAAAAAATCACATAAG Locus tag: Dret_1807 Name: null Funciton: molybdopterin binding domain protein Locus tag: Dret_1808 Name: null Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
	Dret_1807		molybdopterin binding domain protein
	Dret_1808		aldehyde oxidase and xanthine dehydrogenase molybdopterin binding

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD