Regulon of NrtR in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_3450
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Chloroflexia
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 5.8 Sequence: TTAGTGTATAATTTACACTAT Locus tag: Chy400_0205 Name: pncB Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
	Chy400_0205	pncB	Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Position: -90 Score: 5.2 Sequence: TTAGTGACCTCTTGACAATAT Position: -36 Score: 6.4 Sequence: AAAGTGTAATAATAACACTAA Locus tag: Chy400_1521 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: Chy400_1522 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16)
	Chy400_1521	nadA	Quinolinate synthetase (EC 4.1.99.-)
	Chy400_1522	nadB	L-aspartate oxidase (EC 1.4.3.16)
Position: -47 Score: 6.1 Sequence: TTAGTGTATAAATAACACTAA Locus tag: Chy400_3450 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
	Chy400_3450	nrtR	Nudix-related transcriptional regulator NrtR
Position: -37 Score: 5.7 Sequence: ATAGTGTCAGTTTTACACCAA Locus tag: Chy400_4233 Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19)
	Chy400_4233	pncA	Nicotinamidase (EC 3.5.1.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD