Regulon of LexA in Thiobacillus denitrificans

Properties
Regulator type:	Transcription factor
TF locus tag:	Tbd_1483
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Various betaproteobacteria
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Various betaproteobacteria
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -19 Score: 6.5 Sequence: TACTGTATAAAAATACAGCA Locus tag: Tbd_1306 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Tbd_1306	uvrD	ATP-dependent DNA helicase II
Position: -192 Score: 5.9 Sequence: TACTGTATAAATCAACAGTA Locus tag: Tbd_0830 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Tbd_0829 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Tbd_0828 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) Locus tag: Tbd_0827 Name: dnaQ Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
	Tbd_0830	imuA	Predicted RecA/RadA recombinase
	Tbd_0829	imuB	DNA polymerase-like protein PA0670
	Tbd_0828	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
	Tbd_0827	dnaQ	DNA polymerase III epsilon subunit (EC 2.7.7.7)
Position: 125 Score: 5 Sequence: TACTGTACGGACATACAGTA Locus tag: Tbd_1483 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Tbd_1483	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD