Regulon of LexA in Dechloromonas aromatica RCB

Properties
Regulator type:	Transcription factor
TF locus tag:	Daro_1939
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Various betaproteobacteria
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Various betaproteobacteria
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.1 Sequence: TACTGTACAAAAATACAGTC Locus tag: Daro_1939 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Daro_1940 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Daro_1941 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Daro_1942 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Daro_1939	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Daro_1940	imuA	Predicted RecA/RadA recombinase
	Daro_1941	imuB	DNA polymerase-like protein PA0670
	Daro_1942	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -47 Score: 5.7 Sequence: AACTGTGTGAAAATACAGTA Locus tag: Daro_4062 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: Daro_4061 Name: yhhT Funciton: Putative membrane protein Locus tag: Daro_4060 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	Daro_4062	ruvA	Holliday junction DNA helicase RuvA
	Daro_4061	yhhT	Putative membrane protein
	Daro_4060	ruvB	Holliday junction DNA helicase RuvB
Position: -85 Score: 6.2 Sequence: TGCTGTATAAAAAAACAGCC Locus tag: Daro_0473 Name: uvrA Funciton: Excinuclease ABC subunit A
	Daro_0473	uvrA	Excinuclease ABC subunit A
Position: -146 Score: 5.8 Sequence: TACTGTATTTATACACAGTA Locus tag: Daro_4152 Name: recA Funciton: Recombinase A Locus tag: Daro_4151 Name: recX Funciton: Regulatory protein RecX
	Daro_4152	recA	Recombinase A
	Daro_4151	recX	Regulatory protein RecX
Position: -262 Score: 6 Sequence: GGCTGTATATTTATACAGCC Locus tag: Daro_2123 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Daro_2123	dinB	DNA polymerase IV (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD