Regulon of LexA in Thauera sp. MZ1T

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmz1t_2297
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Various betaproteobacteria
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Various betaproteobacteria
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -20 Score: 5.4 Sequence: GGCTGAATATACTTACAGCC Locus tag: Tmz1t_0548 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Tmz1t_0548	uvrD	ATP-dependent DNA helicase II
Position: -37 Score: 5.9 Sequence: GACTGTTTAAAATTACAGCC Locus tag: Tmz1t_2297 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: Tmz1t_2298 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Tmz1t_2299 Name: imuB Funciton: DNA polymerase-like protein PA0670
	Tmz1t_2297	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	Tmz1t_2298	imuA	Predicted RecA/RadA recombinase
	Tmz1t_2299	imuB	DNA polymerase-like protein PA0670
Position: -25 Score: 5.8 Sequence: AACTGTATTTTTATACAGTC Locus tag: Tmz1t_1948 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Tmz1t_1948	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD