Regulon of LexA in Azoarcus sp. EbN1

Properties
Regulator type:	Transcription factor
TF locus tag:	ebA3086
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Various betaproteobacteria
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Various betaproteobacteria
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 5.7 Sequence: ATGTGTATAAATATACAGCA Locus tag: ebA3086 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88) Locus tag: ebA3084 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: ebA3079 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: ebA3077 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	ebA3086	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
	ebA3084	imuA	Predicted RecA/RadA recombinase
	ebA3079	imuB	DNA polymerase-like protein PA0670
	ebA3077	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD