Regulon of LexA in Burkholderia phymatum STM815

Properties
Regulator type:	Transcription factor
TF locus tag:	Bphy_1630
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Burkholderia
Statistics of regulated genes:
- Genes	12
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 75 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Burkholderia
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -25 Score: 6.3 Sequence: CACTGTATATTTGTACAGTA Locus tag: Bphy_0767 Name: PF04055 Funciton: DNA repair photolyase
	Bphy_0767	PF04055	DNA repair photolyase
Position: -44 Score: 6.2 Sequence: TACTGTATGTTTGTACAGTA Locus tag: Bphy_4157 Name: PF10616 Funciton: Protein of unknown function DUF2471 Locus tag: Bphy_4156 Name: PF00589 Funciton: Predicted integrase/recombinase
	Bphy_4157	PF10616	Protein of unknown function DUF2471
	Bphy_4156	PF00589	Predicted integrase/recombinase
Position: -73 Score: 6.3 Sequence: AACTGTATAAACATACAGTA Locus tag: Bphy_1549 Name: uvrA Funciton: Excinuclease ABC subunit A
	Bphy_1549	uvrA	Excinuclease ABC subunit A
Position: -45 Score: 5.7 Sequence: TACTGTATAAAAATACAGGC Position: -25 Score: 5.4 Sequence: ACCTGTCTATCCATACAGTG Locus tag: Bphy_1630 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Bphy_1630	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -121 Score: 6 Sequence: TACTGTTTTTTTATACAGTG Locus tag: Bphy_0440 Name: recA Funciton: Recombinase A Locus tag: Bphy_0441 Name: recX Funciton: Regulatory protein RecX
	Bphy_0440	recA	Recombinase A
	Bphy_0441	recX	Regulatory protein RecX
Position: -34 Score: 6.4 Sequence: TACTGTATAAATATACAGTT Locus tag: Bphy_1972 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Bphy_1971 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Bphy_1970 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Bphy_1972	imuA	Predicted RecA/RadA recombinase
	Bphy_1971	imuB	DNA polymerase-like protein PA0670
	Bphy_1970	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -37 Score: 5.6 Sequence: GGCTGTATAAATATACAGTT Locus tag: Bphy_5308 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Bphy_5309 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
	Bphy_5308	PF08774	Hypothetical protein, restriction endonuclease-like VRR-NUC domain
	Bphy_5309	PF06733	DinG family ATP-dependent helicase CPE1197

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD