Regulon of LexA in Burkholderia xenovorans LB400

Properties
Regulator type:	Transcription factor
TF locus tag:	Bxe_A2471
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Burkholderia
Statistics of regulated genes:
- Genes	11
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 75 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Burkholderia
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 5.9 Sequence: CACTGTATATTTATACAGGT Locus tag: Bxe_A1003 Name: PF04055 Funciton: DNA repair photolyase
	Bxe_A1003	PF04055	DNA repair photolyase
Position: -43 Score: 6.3 Sequence: CACTGTATATTTGTACAGTA Locus tag: Bxe_B3023 Name: PF10616 Funciton: Protein of unknown function DUF2471 Locus tag: Bxe_B3024 Name: PF00589 Funciton: Predicted integrase/recombinase
	Bxe_B3023	PF10616	Protein of unknown function DUF2471
	Bxe_B3024	PF00589	Predicted integrase/recombinase
Position: -109 Score: 6.1 Sequence: ACCTGTATAAATATACAGTA Locus tag: Bxe_A3001 Name: uvrA Funciton: Excinuclease ABC subunit A
	Bxe_A3001	uvrA	Excinuclease ABC subunit A
Position: -45 Score: 6.1 Sequence: TACTGTATAAAAATACAGTC Position: -25 Score: 5.3 Sequence: ACCTGTTCATACATACAGTG Locus tag: Bxe_A2471 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Bxe_A2471	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -112 Score: 6 Sequence: TACTGTTTTTTTATACAGTG Locus tag: Bxe_A0671 Name: recA Funciton: Recombinase A Locus tag: Bxe_A0672 Name: recX Funciton: Regulatory protein RecX
	Bxe_A0671	recA	Recombinase A
	Bxe_A0672	recX	Regulatory protein RecX
Position: -44 Score: 5.7 Sequence: TACTGTATAAATTAACAGTA Locus tag: Bxe_A3818 Name: BPSS1334 Funciton: Conserved hypothetical protein
	Bxe_A3818	BPSS1334	Conserved hypothetical protein
Position: -32 Score: 6.2 Sequence: TACTGTATATCCATACAGTA Locus tag: Bxe_A0227 Name: imuA Funciton: Predicted RecA/RadA recombinase
	Bxe_A0227	imuA	Predicted RecA/RadA recombinase
Position: -34 Score: 5.8 Sequence: CACTGTATATACATACAGGT Locus tag: Bxe_B1179 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Bxe_B1180 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
	Bxe_B1179	PF08774	Hypothetical protein, restriction endonuclease-like VRR-NUC domain
	Bxe_B1180	PF06733	DinG family ATP-dependent helicase CPE1197

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD