Regulon of LexA in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_1g18740
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Burkholderia
Statistics of regulated genes:
- Genes	14
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 75 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Burkholderia
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6.2 Sequence: TACTGTATAAATAAACAGTA Locus tag: bglu_1g09000 Name: PF04055 Funciton: DNA repair photolyase
	bglu_1g09000	PF04055	DNA repair photolyase
Position: -42 Score: 6.3 Sequence: CACTGTATATTTGTACAGTA Locus tag: bglu_2g00070 Name: PF10616 Funciton: Protein of unknown function DUF2471 Locus tag: bglu_2g00060 Name: PF00589 Funciton: Predicted integrase/recombinase
	bglu_2g00070	PF10616	Protein of unknown function DUF2471
	bglu_2g00060	PF00589	Predicted integrase/recombinase
Position: -109 Score: 5.8 Sequence: AGCTGTATGAATATACAGTA Locus tag: bglu_2g07270 Name: uvrA Funciton: Excinuclease ABC subunit A
	bglu_2g07270	uvrA	Excinuclease ABC subunit A
Position: 15 Score: 5.8 Sequence: TACTGTATAAAAATACAGAT Locus tag: bglu_1g18740 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	bglu_1g18740	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -98 Score: 6 Sequence: CACTGTTTTTTTATACAGTG Locus tag: bglu_1g29970 Name: recA Funciton: Recombinase A Locus tag: bglu_1g29960 Name: recX Funciton: Regulatory protein RecX
	bglu_1g29970	recA	Recombinase A
	bglu_1g29960	recX	Regulatory protein RecX
Position: -31 Score: 5.6 Sequence: CACTGTATTCATAAACAGTA Locus tag: bglu_2g10090 Name: BPSS1334 Funciton: Conserved hypothetical protein
	bglu_2g10090	BPSS1334	Conserved hypothetical protein
Position: -32 Score: 6.4 Sequence: TACTGTATAAACATACAGTA Locus tag: bglu_1g31560 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: bglu_1g31550 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: bglu_1g31540 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	bglu_1g31560	imuA	Predicted RecA/RadA recombinase
	bglu_1g31550	imuB	DNA polymerase-like protein PA0670
	bglu_1g31540	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -166 Score: 6.1 Sequence: GACTGTATATTTATACAGTA Locus tag: bglu_4p0880 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: bglu_4p0890 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: bglu_4p0900 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	bglu_4p0880	imuA	Predicted RecA/RadA recombinase
	bglu_4p0890	imuB	DNA polymerase-like protein PA0670
	bglu_4p0900	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Burkholderia glumae BGR1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --