Regulon of LexA in Burkholderia cepacia AMMD

Properties
Regulator type:	Transcription factor
TF locus tag:	Bamb_1496
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Burkholderia
Statistics of regulated genes:
- Genes	14
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 75 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Burkholderia
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 6.5 Sequence: TACTGTATAAATATACAGTA Locus tag: Bamb_0942 Name: PF04055 Funciton: DNA repair photolyase
	Bamb_0942	PF04055	DNA repair photolyase
Position: -89 Score: 6.2 Sequence: TACTGTATGTTTGTACAGTA Locus tag: Bamb_4970 Name: PF10616 Funciton: Protein of unknown function DUF2471 Locus tag: Bamb_4969 Name: PF00589 Funciton: Predicted integrase/recombinase
	Bamb_4970	PF10616	Protein of unknown function DUF2471
	Bamb_4969	PF00589	Predicted integrase/recombinase
Position: -57 Score: 6.2 Sequence: AACTGTATGAATATACAGTA Locus tag: Bamb_6248 Name: uvrA Funciton: Excinuclease ABC subunit A
	Bamb_6248	uvrA	Excinuclease ABC subunit A
Position: -45 Score: 5.9 Sequence: TACTGTATAAAAATACAGCT Position: -25 Score: 5.8 Sequence: CACTGTCTATCCATACAGTT Locus tag: Bamb_1496 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	Bamb_1496	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -93 Score: 6 Sequence: CACTGTTTTTTTATACAGTG Locus tag: Bamb_2699 Name: recA Funciton: Recombinase A Locus tag: Bamb_2698 Name: recX Funciton: Regulatory protein RecX
	Bamb_2699	recA	Recombinase A
	Bamb_2698	recX	Regulatory protein RecX
Position: -29 Score: 5.3 Sequence: TACTGGATTTATGAACAGTG Locus tag: Bamb_3559 Name: BPSS1334 Funciton: Conserved hypothetical protein
	Bamb_3559	BPSS1334	Conserved hypothetical protein
Position: -32 Score: 6.1 Sequence: TACTGTATATCCATACAGTT Locus tag: Bamb_2888 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Bamb_2887 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Bamb_2886 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	Bamb_2888	imuA	Predicted RecA/RadA recombinase
	Bamb_2887	imuB	DNA polymerase-like protein PA0670
	Bamb_2886	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -4 Score: 5.9 Sequence: CACTGTGTTTTTGTACAGTA Locus tag: Bamb_2179 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Bamb_2179	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -30 Score: 5.4 Sequence: ACCTGTACAAACGTACAGTG Locus tag: Bamb_3800 Name: PF08774 Funciton: Hypothetical protein, restriction endonuclease-like VRR-NUC domain Locus tag: Bamb_3801 Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197
	Bamb_3800	PF08774	Hypothetical protein, restriction endonuclease-like VRR-NUC domain
	Bamb_3801	PF06733	DinG family ATP-dependent helicase CPE1197

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Burkholderia cepacia AMMD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --