Regulon of LexA in Burkholderia mallei ATCC 23344

Properties
Regulator type:	Transcription factor
TF locus tag:	BMA1211
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Burkholderia
Statistics of regulated genes:
- Genes	10
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 75 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Burkholderia
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 6.3 Sequence: TACTGTATGTTTATACAGTA Locus tag: BMA0406 Name: PF04055 Funciton: DNA repair photolyase
	BMA0406	PF04055	DNA repair photolyase
Position: -92 Score: 6.2 Sequence: TACTGTATATTCGTACAGTA Locus tag: BMAA0003 Name: PF10616 Funciton: Protein of unknown function DUF2471 Locus tag: BMAA0002 Name: PF00589 Funciton: Predicted integrase/recombinase
	BMAA0003	PF10616	Protein of unknown function DUF2471
	BMAA0002	PF00589	Predicted integrase/recombinase
Position: -143 Score: 5.6 Sequence: AGCTGTATAAATATCCAGTA Locus tag: BMAA0062 Name: uvrA Funciton: Excinuclease ABC subunit A
	BMAA0062	uvrA	Excinuclease ABC subunit A
Position: -45 Score: 5.8 Sequence: TACTGTATAAAAATACAGAT Position: -25 Score: 5.6 Sequence: CACTGTCTATCCATACAGTC Locus tag: BMA1211 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	BMA1211	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -108 Score: 6 Sequence: CACTGTTTTTTTATACAGTG Locus tag: BMA0272 Name: recA Funciton: Recombinase A Locus tag: BMA0273 Name: recX Funciton: Regulatory protein RecX
	BMA0272	recA	Recombinase A
	BMA0273	recX	Regulatory protein RecX
Position: 22 Score: 5.1 Sequence: TACTGGATAAATTAACAGTA Locus tag: BMAA0943 Name: BPSS1334 Funciton: Conserved hypothetical protein
	BMAA0943	BPSS1334	Conserved hypothetical protein
Position: -32 Score: 6.3 Sequence: TACTGTATAAACGTACAGTA Locus tag: BMA3143 Name: imuA Funciton: Predicted RecA/RadA recombinase
	BMA3143	imuA	Predicted RecA/RadA recombinase
Position: -28 Score: 5.9 Sequence: CACTGTGTTTTTGTACAGTA Locus tag: BMA1727 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	BMA1727	dinB	DNA polymerase IV (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD