Regulon of LexA in Burkholderia pseudomallei K96243

Properties
Regulator type:	Transcription factor
TF locus tag:	BPSL1840
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Burkholderia
Statistics of regulated genes:
- Genes	9
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 75 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Burkholderia
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6.3 Sequence: TACTGTATGTTTATACAGTA Locus tag: BPSL2495 Name: PF04055 Funciton: DNA repair photolyase
	BPSL2495	PF04055	DNA repair photolyase
Position: 10 Score: 6.2 Sequence: TACTGTATATTCGTACAGTA Locus tag: BPSS0003 Name: PF10616 Funciton: Protein of unknown function DUF2471 Locus tag: BPSS0002 Name: PF00589 Funciton: Predicted integrase/recombinase
	BPSS0003	PF10616	Protein of unknown function DUF2471
	BPSS0002	PF00589	Predicted integrase/recombinase
Position: -143 Score: 5.6 Sequence: AGCTGTATAAATATCCAGTA Locus tag: BPSS0058 Name: uvrA Funciton: Excinuclease ABC subunit A
	BPSS0058	uvrA	Excinuclease ABC subunit A
Position: -108 Score: 6 Sequence: CACTGTTTTTTTATACAGTG Locus tag: BPSL0776 Name: recA Funciton: Recombinase A Locus tag: BPSL0777 Name: recX Funciton: Regulatory protein RecX
	BPSL0776	recA	Recombinase A
	BPSL0777	recX	Regulatory protein RecX
Position: -45 Score: 5.9 Sequence: TACTGTATAAAAATACAGCT Position: -25 Score: 5.6 Sequence: CACTGTCTATCCATACAGTC Locus tag: BPSL1840 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	BPSL1840	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -29 Score: 5.7 Sequence: TACTGTATTTATGTCCAGTG Locus tag: BPSS1334 Name: BPSS1334 Funciton: Conserved hypothetical protein
	BPSS1334	BPSS1334	Conserved hypothetical protein
Position: -28 Score: 5.9 Sequence: CACTGTGTTTTTGTACAGTA Locus tag: BPSL2306 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	BPSL2306	dinB	DNA polymerase IV (EC 2.7.7.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD