Regulon of ModE in Desulfuromonas acetoxidans DSM 684
| Regulator type: | Transcription factor |
| TF locus tag: | Dace_1432 |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Regulog: | ModE - Desulfuromonadales |
| Statistics of regulated genes: | |
| - Genes | 4 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfuromonadales
- By trascription factor - ModE
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -86
Score: 5.7 Sequence: TTGCGTTGTATAGCGTGGCATATAGCGTAA
Locus tag: Dace_2070
Name: omp_mod Funciton: predicted TonB-dependent outer memberane transporter for molybdate
Locus tag: Dace_2069
Name: Dace2069 Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
Locus tag: Dace_2068
Name: Dace_2068 Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
Locus tag: Dace_2067
Name: Dace_2067 Funciton: Core component Dace_2067 of predicted ECF transporter |
|||
|
omp_mod
|
predicted TonB-dependent outer memberane transporter for molybdate
|
||
|
Dace2069
|
Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
|
||
|
Dace_2068
|
Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
|
||
|
Dace_2067
|
Core component Dace_2067 of predicted ECF transporter
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |