Regulon of ModE in Desulfuromonas acetoxidans DSM 684

Properties
Regulator type:	Transcription factor
TF locus tag:	Dace_1432
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Desulfuromonadales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 5.7 Sequence: TTGCGTTGTATAGCGTGGCATATAGCGTAA Locus tag: Dace_2070 Name: omp_mod Funciton: predicted TonB-dependent outer memberane transporter for molybdate Locus tag: Dace_2069 Name: Dace2069 Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter Locus tag: Dace_2068 Name: Dace_2068 Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter Locus tag: Dace_2067 Name: Dace_2067 Funciton: Core component Dace_2067 of predicted ECF transporter
	Dace_2070	omp_mod	predicted TonB-dependent outer memberane transporter for molybdate
	Dace_2069	Dace2069	Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
	Dace_2068	Dace_2068	Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
	Dace_2067	Dace_2067	Core component Dace_2067 of predicted ECF transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD