Regulon of ModE in Pelobacter propionicus DSM 2379

Properties
Regulator type:	Transcription factor
TF locus tag:	Ppro_1529
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Desulfuromonadales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 5.1 Sequence: GGTCGCTATATATCAAAAAACACTGCGCTC Locus tag: Ppro_1963 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Ppro_1963	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Position: -107 Score: 5.7 Sequence: CATCGTTATTACTAATACTATATAACTACG Locus tag: Ppro_1541 Name: omp_mod Funciton: predicted TonB-dependent outer memberane transporter for molybdate Locus tag: Ppro_1540 Name: Dace2069 Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter Locus tag: Ppro_1539 Name: Dace_2068 Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter Locus tag: Ppro_1538 Name: Dace_2067 Funciton: Core component Dace_2067 of predicted ECF transporter
	Ppro_1541	omp_mod	predicted TonB-dependent outer memberane transporter for molybdate
	Ppro_1540	Dace2069	Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
	Ppro_1539	Dace_2068	Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
	Ppro_1538	Dace_2067	Core component Dace_2067 of predicted ECF transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD