Regulon of ModE in Geobacter sulfurreducens PCA

Properties
Regulator type:	Transcription factor
TF locus tag:	GSU2964
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Desulfuromonadales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -160 Score: 5.8 Sequence: TATCGTTATGTCATGAAGGTTATAGCGTTT Locus tag: GSU2963 Name: modD Funciton: Molybdenum transport system protein ModD Locus tag: GSU2962 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: GSU2961 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: GSU2960 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	GSU2963	modD	Molybdenum transport system protein ModD
	GSU2962	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	GSU2961	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	GSU2960	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD