Regulon of ModE2 in Novosphingobium aromaticivorans DSM 12444

Properties
Regulator type:	Transcription factor
TF locus tag:	Saro_2514
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE2 - Sphingomonadales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 5.1 Sequence: ACTGTATACTTCGGAACATAGC Locus tag: Saro_0212 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Saro_0213 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Saro_0214 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	Saro_0212	modA	Molybdate ABC transporter, substrate-binding protein
	Saro_0213	modB	Molybdate ABC transporter, permease protein
	Saro_0214	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD