Regulog ModE2 - Sphingomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444	3	1
Sphingopyxis alaskensis RB2256
Sphingobium japonicum UT26S
Sphingomonas wittichii RW1	3	1
Zymomonas mobilis subsp. mobilis ZM4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
modA	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	* Novosphingobium aromaticivorans DSM 12444 Site: position = -53 score = 5.11765 sequence = ACTGTATACTTCGGAACATAGC Gene: Saro_0212: Molybdate ABC transporter, substrate-binding protein	Sphingopyxis alaskensis RB2256 Gene: Sala_0550: Molybdate ABC transporter, substrate-binding protein	Sphingobium japonicum UT26S Gene: SJA_C1-33060: Molybdate ABC transporter, substrate-binding protein	* Sphingomonas wittichii RW1 Site: position = -54 score = 5.15115 sequence = GCCATATATTATGGGATATAGC Gene: Swit_4418: Molybdate ABC transporter, substrate-binding protein	Zymomonas mobilis subsp. mobilis ZM4	Molybdate ABC transporter, substrate-binding protein
modB	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_0213: Molybdate ABC transporter, permease protein	Sphingopyxis alaskensis RB2256 Gene: Sala_0551: Molybdate ABC transporter, permease protein	Sphingobium japonicum UT26S Gene: SJA_C1-33080: Molybdate ABC transporter, permease protein	Sphingomonas wittichii RW1 Gene: Swit_4417: Molybdate ABC transporter, permease protein	Zymomonas mobilis subsp. mobilis ZM4	Molybdate ABC transporter, permease protein
modC	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	Novosphingobium aromaticivorans DSM 12444 Gene: Saro_0214: Molybdate ABC transporter, ATP-binding protein	Sphingopyxis alaskensis RB2256 Gene: Sala_0552: Molybdate ABC transporter, ATP-binding protein	Sphingobium japonicum UT26S Gene: SJA_C1-33090: Molybdate ABC transporter, ATP-binding protein	Sphingomonas wittichii RW1 Gene: Swit_4416: Molybdate ABC transporter, ATP-binding protein	Zymomonas mobilis subsp. mobilis ZM4	Molybdate ABC transporter, ATP-binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ModE2 - Sphingomonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --