Regulog ModE2 - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By trascription factor - ModE
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | ||
| Erythrobacter sp. NAP1 | ||
| Novosphingobium aromaticivorans DSM 12444 | 3 | 1 |
| Sphingopyxis alaskensis RB2256 | ||
| Sphingobium japonicum UT26S | ||
| Sphingomonas wittichii RW1 | 3 | 1 |
| Zymomonas mobilis subsp. mobilis ZM4 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| modA |
|
|
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -53 score = 5.11765 sequence = ACTGTATACTTCGGAACATAGC Gene: Saro_0212: Molybdate ABC transporter, substrate-binding protein |
Gene: Sala_0550: Molybdate ABC transporter, substrate-binding protein |
Gene: SJA_C1-33060: Molybdate ABC transporter, substrate-binding protein |
*
Sphingomonas wittichii RW1 Site: position = -54 score = 5.15115 sequence = GCCATATATTATGGGATATAGC Gene: Swit_4418: Molybdate ABC transporter, substrate-binding protein |
|
Molybdate ABC transporter, substrate-binding protein |
| modB |
|
|
Gene: Saro_0213: Molybdate ABC transporter, permease protein |
Gene: Sala_0551: Molybdate ABC transporter, permease protein |
Gene: SJA_C1-33080: Molybdate ABC transporter, permease protein |
Gene: Swit_4417: Molybdate ABC transporter, permease protein |
|
Molybdate ABC transporter, permease protein |
| modC |
|
|
Gene: Saro_0214: Molybdate ABC transporter, ATP-binding protein |
Gene: Sala_0552: Molybdate ABC transporter, ATP-binding protein |
Gene: SJA_C1-33090: Molybdate ABC transporter, ATP-binding protein |
Gene: Swit_4416: Molybdate ABC transporter, ATP-binding protein |
|
Molybdate ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |