Regulon of ModE2 in Azospirillum sp. B510

Properties
Regulator type:	Transcription factor
TF locus tag:	AZL_016350
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE2 - Rhodospirillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -21 Score: 5.4 Sequence: GCTGTATCCGTTTGAATATATA Locus tag: AZL_015260 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: AZL_015250 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: AZL_015240 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	AZL_015260	modA	Molybdate ABC transporter, substrate-binding protein
	AZL_015250	modB	Molybdate ABC transporter, permease protein
	AZL_015240	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD