Regulon of ModE in Tolumonas auensis DSM 9187

Properties
Regulator type:	Transcription factor
TF locus tag:	Tola_1199, Tola_0298
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 6.1 Sequence: ATCGCTATATAAATAAATATATGGCGTT Locus tag: Tola_1211 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein
	Tola_1211	modA	Molybdate ABC transporter, substrate-binding protein
Position: -37 Score: 5.5 Sequence: TACGCTGTATAGAAATATACATATCGAG Locus tag: Tola_1199 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	Tola_1199	modE	Molybdate-responsive transcriptional regulator ModE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD