Regulog ModE - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - ModE
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 | ||
| Moritella sp. PE36 | 3 | 1 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||
| Aeromonas salmonicida subsp. salmonicida A449 | ||
| Tolumonas auensis DSM 9187 | 2 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| modA |
Gene: Ping_2166: Molybdate ABC transporter, substrate-binding protein |
Gene: PCNPT3_07840: Molybdate ABC transporter, substrate-binding protein |
*
Moritella sp. PE36 Site: position = -75 score = 5.72919 sequence = ATCGATATATAGCTTACTATACAGCGCT Gene: PE36_17160: Molybdate ABC transporter, substrate-binding protein |
|
|
*
Tolumonas auensis DSM 9187 Site: position = -87 score = 6.10732 sequence = ATCGCTATATAAATAAATATATGGCGTT Gene: Tola_1211: Molybdate ABC transporter, substrate-binding protein |
Molybdate ABC transporter, substrate-binding protein |
| modB |
Gene: Ping_2165: Molybdate ABC transporter, permease protein |
Gene: PCNPT3_07835: Molybdate ABC transporter, permease protein |
Gene: PE36_17165: Molybdate ABC transporter, permease protein |
Gene: AHA_1596: Molybdate ABC transporter, permease protein |
Gene: ASA_2761: Molybdate ABC transporter, permease protein |
Gene: Tola_0297: Molybdate ABC transporter, permease protein |
Molybdate ABC transporter, permease protein |
| modC |
Gene: Ping_2164: Molybdate ABC transporter, ATP-binding protein |
Gene: PCNPT3_07830: Molybdate ABC transporter, ATP-binding protein |
Gene: PE36_17170: Molybdate ABC transporter, ATP-binding protein |
Gene: AHA_1597: Molybdate ABC transporter, ATP-binding protein |
Gene: ASA_2760: Molybdate ABC transporter, ATP-binding protein |
Gene: Tola_0296: Molybdate ABC transporter, ATP-binding protein |
Molybdate ABC transporter, ATP-binding protein |
| modE |
|
|
Gene: PE36_17140: Molybdate-responsive transcriptional regulator ModE |
|
|
*2
Tolumonas auensis DSM 9187 Site: position = -37 score = 5.47241 sequence = TACGCTGTATAGAAATATACATATCGAG Gene: Tola_1199: Molybdate-responsive transcriptional regulator ModE Gene: Tola_0298: Molybdate-responsive transcriptional regulator ModE |
Molybdate-responsive transcriptional regulator ModE |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |