Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog ModE - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Moritella sp. PE36 3 1
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Aeromonas salmonicida subsp. salmonicida A449
Tolumonas auensis DSM 9187 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
 
Psychromonas ingrahamii 37

Gene: Ping_2166: Molybdate ABC transporter, substrate-binding protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07840: Molybdate ABC transporter, substrate-binding protein
*
Moritella sp. PE36

Site:
position = -75
score = 5.72919
sequence = ATCGATATATAGCTTACTATACAGCGCT

Gene: PE36_17160: Molybdate ABC transporter, substrate-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
*
Tolumonas auensis DSM 9187

Site:
position = -87
score = 6.10732
sequence = ATCGCTATATAAATAAATATATGGCGTT

Gene: Tola_1211: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modB
 
Psychromonas ingrahamii 37

Gene: Ping_2165: Molybdate ABC transporter, permease protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07835: Molybdate ABC transporter, permease protein
 
Moritella sp. PE36

Gene: PE36_17165: Molybdate ABC transporter, permease protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1596: Molybdate ABC transporter, permease protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2761: Molybdate ABC transporter, permease protein
 
Tolumonas auensis DSM 9187

Gene: Tola_0297: Molybdate ABC transporter, permease protein
Molybdate ABC transporter, permease protein
modC
 
Psychromonas ingrahamii 37

Gene: Ping_2164: Molybdate ABC transporter, ATP-binding protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_07830: Molybdate ABC transporter, ATP-binding protein
 
Moritella sp. PE36

Gene: PE36_17170: Molybdate ABC transporter, ATP-binding protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1597: Molybdate ABC transporter, ATP-binding protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2760: Molybdate ABC transporter, ATP-binding protein
 
Tolumonas auensis DSM 9187

Gene: Tola_0296: Molybdate ABC transporter, ATP-binding protein
Molybdate ABC transporter, ATP-binding protein
modE
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_17140: Molybdate-responsive transcriptional regulator ModE
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
*2
Tolumonas auensis DSM 9187

Site:
position = -37
score = 5.47241
sequence = TACGCTGTATAGAAATATACATATCGAG

Gene: Tola_1199: Molybdate-responsive transcriptional regulator ModE

Gene: Tola_0298: Molybdate-responsive transcriptional regulator ModE
Molybdate-responsive transcriptional regulator ModE
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise