Regulon of TrpR in Psychrobacter arcticum 273-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Psyc_1666
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Regulog:	TrpR - Moraxellaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - TrpR
By TF family - TrpR
By effector - Tryptophan
By pathway - Tryptophan biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 5 Sequence: TGTACTACTGTACTAGAATA Locus tag: Psyc_1666 Name: trpR Funciton: Trp operon repressor Locus tag: Psyc_1667 Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27) Locus tag: Psyc_1668 Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
	Psyc_1666	trpR	Trp operon repressor
	Psyc_1667	trpE	Anthranilate synthase, aminase component (EC 4.1.3.27)
	Psyc_1668	trpG	Anthranilate synthase, amidotransferase component (EC 4.1.3.27)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD