Regulog TrpR - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - TrpR
- By TF family - TrpR
- By effector - Tryptophan
- By pathway - Tryptophan biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | ||
| Acinetobacter baumannii AB0057 | ||
| Psychrobacter arcticum 273-4 | 3 | 1 |
| Psychrobacter sp. PRwf-1 | 4 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| trpR |
|
|
*
Psychrobacter arcticum 273-4 Site: position = -70 score = 5.0181 sequence = TGTACTACTGTACTAGAATA Gene: Psyc_1666: Trp operon repressor |
*
Psychrobacter sp. PRwf-1 Site: position = -48 score = 5.0181 sequence = TGTACTACTGTACTAGAATA Gene: PsycPRwf_1155: Trp operon repressor |
Trp operon repressor |
| trpE |
|
|
Gene: Psyc_1667: Anthranilate synthase, aminase component (EC 4.1.3.27) |
Gene: PsycPRwf_1154: Anthranilate synthase, aminase component (EC 4.1.3.27) |
Anthranilate synthase, aminase component (EC 4.1.3.27) |
| trpG |
|
|
Gene: Psyc_1668: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) |
Gene: PsycPRwf_1153: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) |
Anthranilate synthase, amidotransferase component (EC 4.1.3.27) |
| CRON 2. | |||||
| trpB |
|
|
|
*
Psychrobacter sp. PRwf-1 Site: position = -130 score = 4.80687 sequence = CGTATCAGTGTACTAGAACA Gene: PsycPRwf_1460: Tryptophan synthase beta chain like (EC 4.2.1.20) |
Tryptophan synthase beta chain like (EC 4.2.1.20) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |