Regulon of TrpR in Reinekea sp. MED297

Properties
Regulator type:	Transcription factor
TF locus tag:	MED297_18498
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Regulog:	TrpR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - TrpR
By TF family - TrpR
By effector - Tryptophan
By pathway - Tryptophan biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -19 Score: 4.5 Sequence: TGTTATAGCATACTAGTACA Locus tag: MED297_18498 Name: trpR Funciton: Trp operon repressor Locus tag: MED297_18503 Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27) Locus tag: MED297_18508 Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
	MED297_18498	trpR	Trp operon repressor
	MED297_18503	trpE	Anthranilate synthase, aminase component (EC 4.1.3.27)
	MED297_18508	trpG	Anthranilate synthase, amidotransferase component (EC 4.1.3.27)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD