Profile of regulator TrpR in Oceanospirillales/Alteromonadales
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Regulog: | TrpR - Oceanospirillales/Alteromonadales |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - TrpR
- By TF family - TrpR
- By effector - Tryptophan
- By pathway - Tryptophan biosynthesis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Marinomonas sp. MWYL1 | |||||
| Mmwyl1_0659 | trpR | -45 | 4.3 | TGTACTAGTACATGAATACA | |
| Reinekea sp. MED297 | |||||
| MED297_18498 | trpR | -19 | 4.5 | TGTTATAGCATACTAGTACA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |