Regulon of GlcC in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mll6911
Regulator family:	GntR/Others
Regulation mode:	activator (repressor)
Biological process:	Glycolate utilization
Effector:	Glycolate
Regulog:	GlcC - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - GlcC
By TF family - GntR/Others
By effector - Glycolate
By pathway - Glycolate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 4.6 Sequence: AATTGGATAAATAATTTGACCAGTT Locus tag: mll6911 Name: glcC Funciton: Glycolate utilization operon transcriptional activator Locus tag: mll6909 Name: lldD Funciton: L-lactate dehydrogenase (EC 1.1.2.3)
	mll6911	glcC	Glycolate utilization operon transcriptional activator
	mll6909	lldD	L-lactate dehydrogenase (EC 1.1.2.3)
Position: -113 Score: 4.4 Sequence: CACTGGTAAAAGATTTTGACCAGTG Locus tag: mlr6916 Name: glcD Funciton: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD Locus tag: mlr6918 Name: null Funciton: hypothetical protein Locus tag: mlr6919 Name: glcE Funciton: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE Locus tag: mlr6920 Name: glcF Funciton: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
	mlr6916	glcD	Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
	mlr6918		hypothetical protein
	mlr6919	glcE	Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
	mlr6920	glcF	Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
Position: -156 Score: 5.2 Sequence: AACTGGTCAAATTATTTATCCAATT Locus tag: mlr6914 Name: mlr6914 Funciton: uncharacterized conserved membrane protein
	mlr6914	mlr6914	uncharacterized conserved membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD