Regulon of GlcC in Mesorhizobium sp. BNC1

Properties
Regulator type:	Transcription factor
TF locus tag:	Meso_0366
Regulator family:	GntR/Others
Regulation mode:	activator (repressor)
Biological process:	Glycolate utilization
Effector:	Glycolate
Regulog:	GlcC - Rhizobiales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - GlcC
By TF family - GntR/Others
By effector - Glycolate
By pathway - Glycolate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 4.1 Sequence: CATTGGACAAATAAGTTGACCAGTT Locus tag: Meso_0366 Name: glcC Funciton: Glycolate utilization operon transcriptional activator Locus tag: Meso_0367 Name: ykgE Funciton: L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE Locus tag: Meso_0368 Name: ykgF Funciton: L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF Locus tag: Meso_0369 Name: ykgG Funciton: L-lactate dehydrogenase, hypothetical protein subunit YkgG
	Meso_0366	glcC	Glycolate utilization operon transcriptional activator
	Meso_0367	ykgE	L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
	Meso_0368	ykgF	L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
	Meso_0369	ykgG	L-lactate dehydrogenase, hypothetical protein subunit YkgG
Position: -36 Score: 4.7 Sequence: AACTGGTAAATAGATTAGACCAGTG Locus tag: Meso_0364 Name: glcD Funciton: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD Locus tag: Meso_0363 Name: glcE Funciton: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE Locus tag: Meso_0362 Name: NGR_c03940 Funciton: hypothetical protein Locus tag: Meso_0361 Name: glcF Funciton: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
	Meso_0364	glcD	Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
	Meso_0363	glcE	Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
	Meso_0362	NGR_c03940	hypothetical protein
	Meso_0361	glcF	Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
Position: -119 Score: 4.2 Sequence: AACTGGTCAACTTATTTGTCCAATG Locus tag: Meso_0365 Name: mlr6914 Funciton: uncharacterized conserved membrane protein
	Meso_0365	mlr6914	uncharacterized conserved membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD