Regulon of GlcC in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu0662
Regulator family:	GntR/Others
Regulation mode:	activator (repressor)
Biological process:	Glycolate utilization
Effector:	Glycolate
Regulog:	GlcC - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - GlcC
By TF family - GntR/Others
By effector - Glycolate
By pathway - Glycolate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 4.9 Sequence: AACTGGTATTCTTTCTTTACCACTT Locus tag: Atu0664 Name: lysR Funciton: Transcriptional regulator, LysR family, in glycolate utilization operon
	Atu0664	lysR	Transcriptional regulator, LysR family, in glycolate utilization operon
Position: -90 Score: 4.9 Sequence: AACTGGATAGAATAATTGACCAGTA Locus tag: Atu0662 Name: glcC Funciton: Glycolate utilization operon transcriptional activator
	Atu0662	glcC	Glycolate utilization operon transcriptional activator
Position: -51 Score: 5.6 Sequence: AAGTGGTAAAGAAAGAATACCAGTT Locus tag: Atu0665 Name: glcD Funciton: Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD Locus tag: Atu0666 Name: glcE Funciton: Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE Locus tag: Atu0667 Name: glcF Funciton: Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF
	Atu0665	glcD	Glycolate dehydrogenase (EC 1.1.99.14), subunit GlcD
	Atu0666	glcE	Glycolate dehydrogenase (EC 1.1.99.14), FAD-binding subunit GlcE
	Atu0667	glcF	Glycolate dehydrogenase (EC 1.1.99.14), iron-sulfur subunit GlcF

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD