Regulon of GlcC in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c03890
Regulator family:	GntR/Others
Regulation mode:	activator (repressor)
Biological process:	Glycolate utilization
Effector:	Glycolate
Regulog:	GlcC - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - GlcC
By TF family - GntR/Others
By effector - Glycolate
By pathway - Glycolate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 5.1 Sequence: AAGTGGACAATCGATTTGACCACTT Locus tag: NGR_c03890 Name: glcC Funciton: Glycolate utilization operon transcriptional activator
	NGR_c03890	glcC	Glycolate utilization operon transcriptional activator
Position: -202 Score: 4.6 Sequence: AAGAGGTCAATTTTTTTGACCTCTT Locus tag: NGR_c23940 Name: lldD Funciton: L-lactate dehydrogenase (EC 1.1.2.3)
	NGR_c23940	lldD	L-lactate dehydrogenase (EC 1.1.2.3)
Position: -134 Score: 6.3 Sequence: AAGTGGTCAAATCGATTGTCCACTT Locus tag: NGR_c03900 Name: mlr6914 Funciton: uncharacterized conserved membrane protein
	NGR_c03900	mlr6914	uncharacterized conserved membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD