Regulon of Irr in Bradyrhizobium sp. BTAi1

Properties
Regulator type:	Transcription factor
TF locus tag:	BBta_0071
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhizobiales
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 122 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhizobiales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: 94 Score: 4.3 Sequence: AGaTTgGAATAgcTtcAAAag Locus tag: BBta_6243 Name: bfd Funciton: [2Fe-2S]-binding protein, bacterioferritin Locus tag: BBta_6242 Name: bfr Funciton: Bacterioferritin
	BBta_6243	bfd	[2Fe-2S]-binding protein, bacterioferritin
	BBta_6242	bfr	Bacterioferritin
Position: -58 Score: 6 Sequence: ACTTTAGAAGCGTTCTAAACA Locus tag: BBta_7128 Name: mbfA Funciton: membrane-bound ferritin
	BBta_7128	mbfA	membrane-bound ferritin
Position: -79 Score: 5.1 Sequence: TGTTTAAAATCGCTCTAAGAT Locus tag: BBta_6109 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: BBta_6110 Name: feoB Funciton: Ferrous iron transport protein B
	BBta_6109	feoA	Ferrous iron transport protein A
	BBta_6110	feoB	Ferrous iron transport protein B
Position: -102 Score: 4.3 Sequence: AGTTTAGGGGCGTTCTAGATC Locus tag: BBta_0071 Name: null Funciton: Iron-responsive regulator Irr
	BBta_0071		Iron-responsive regulator Irr
Position: -199 Score: 4.9 Sequence: GTTTTAGAACGATTTCAAGTT Position: -157 Score: 5 Sequence: TTTTTAGAATTGTTTTGATCT Locus tag: BBta_3540 Name: fiu Funciton: TonB-dependent siderophore recepror Locus tag: BBta_3541 Name: piuC Funciton: Hydrolase, involved in iron uptake Locus tag: BBta_3543 Name: exbB2 Funciton: Ferric siderophore transport system, proton channel Locus tag: BBta_3544 Name: exbD2 Funciton: biopolymer transport protein ExbD Locus tag: BBta_3545 Name: tonB2 Funciton: Ferric siderophore transport system energy transducer
	BBta_3540	fiu	TonB-dependent siderophore recepror
	BBta_3541	piuC	Hydrolase, involved in iron uptake
	BBta_3543	exbB2	Ferric siderophore transport system, proton channel
	BBta_3544	exbD2	biopolymer transport protein ExbD
	BBta_3545	tonB2	Ferric siderophore transport system energy transducer

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD