Regulon of Irr in Bradyrhizobium japonicum USDA 110

Properties
Regulator type:	Transcription factor
TF locus tag:	blr1216, bll0768
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhizobiales
Statistics of regulated genes:
- Genes	20
- Operons	11
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 122 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhizobiales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 5.7 Sequence: CATTTAGAAGCGTTCTAAATT Locus tag: bll6680 Name: bfr Funciton: Bacterioferritin
	bll6680	bfr	Bacterioferritin
Position: -38 Score: 6.7 Sequence: AATTTAGAATCATTCTAAACT Locus tag: blr7895 Name: mbfA Funciton: membrane-bound ferritin
	blr7895	mbfA	membrane-bound ferritin
Position: -52 Score: 5.1 Sequence: TGATTTGAACAGTTCCAATTT Locus tag: bll2737 Name: coxS Funciton: Isoquinoline 1-oxidoreductase alpha subunit (EC 1.3.99.16) Locus tag: bll2736 Name: coxL Funciton: Isoquinoline 1-oxidoreductase beta subunit (EC 1.3.99.16)
	bll2737	coxS	Isoquinoline 1-oxidoreductase alpha subunit (EC 1.3.99.16)
	bll2736	coxL	Isoquinoline 1-oxidoreductase beta subunit (EC 1.3.99.16)
Position: -116 Score: 5.1 Sequence: CGCTTAGAACCATTCAACACT Locus tag: bll7968 Name: fhuA3 Funciton: Ferrichrome-iron outer membrane receptor Locus tag: bll7967 Name: piuB Funciton: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
	bll7968	fhuA3	Ferrichrome-iron outer membrane receptor
	bll7967	piuB	Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
Position: -79 Score: 5 Sequence: ACTTTAAAATCACTCTAAGGT Locus tag: bsr6522 Name: null Funciton: Ferrous iron transport protein A Locus tag: blr6523 Name: null Funciton: Ferrous iron transport protein B
	bsr6522		Ferrous iron transport protein A
	blr6523		Ferrous iron transport protein B
Position: -302 Score: 4.7 Sequence: AGTTTATATCGATTGTAAATT Locus tag: blr7077 Name: hmuT Funciton: Hemin ABC transporter, hemin-binding protein Locus tag: blr7078 Name: hmuU Funciton: Hemin ABC transporter, permease protein Locus tag: blr7079 Name: hmuV Funciton: Hemin ABC transporter, ATPase component
	blr7077	hmuT	Hemin ABC transporter, hemin-binding protein
	blr7078	hmuU	Hemin ABC transporter, permease protein
	blr7079	hmuV	Hemin ABC transporter, ATPase component
Position: -167 Score: 4.7 Sequence: AATTTACAATCGATATAAACT Locus tag: bll7076 Name: hmuR Funciton: TonB-dependent haem/haemoglobin receptor
	bll7076	hmuR	TonB-dependent haem/haemoglobin receptor
Position: -128 Score: 5.2 Sequence: ATTTTAGAGCCGTTCTAGGCT Position: -96 Score: 4.9 Sequence: AGTTTGGAATAGCTTCAAATA Locus tag: bsl6681 Name: bfd Funciton: [2Fe-2S]-binding protein, bacterioferritin
	bsl6681	bfd	[2Fe-2S]-binding protein, bacterioferritin
Position: -169 Score: 4.8 Sequence: CGTCTAGAAGGATTCCAAATC Locus tag: blr4504 Name: fhuA1 Funciton: Outer membrane receptor for ferrienterochelin and colicins
	blr4504	fhuA1	Outer membrane receptor for ferrienterochelin and colicins
Position: -62 Score: 4.6 Sequence: AGCTTAGAACGCTTCTATGCC Locus tag: bll5796 Name: fumA Funciton: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
	bll5796	fumA	Fumarate hydratase class I, aerobic (EC 4.2.1.2)
Position: -184 Score: 4.9 Sequence: GTTTTAGAACGACTCCAATTT Position: -162 Score: 5.7 Sequence: ACTTTAGAACCGTTTGAAACT Position: -139 Score: 4.9 Sequence: AGATTAGAATCGTTTTGATCT Locus tag: blr3904 Name: fiu Funciton: TonB-dependent siderophore recepror Locus tag: blr3905 Name: piuC Funciton: Hydrolase, involved in iron uptake Locus tag: blr3906 Name: exbB2 Funciton: Ferric siderophore transport system, proton channel Locus tag: blr3907 Name: exbD2 Funciton: biopolymer transport protein ExbD Locus tag: blr3908 Name: tonB2 Funciton: Ferric siderophore transport system energy transducer
	blr3904	fiu	TonB-dependent siderophore recepror
	blr3905	piuC	Hydrolase, involved in iron uptake
	blr3906	exbB2	Ferric siderophore transport system, proton channel
	blr3907	exbD2	biopolymer transport protein ExbD
	blr3908	tonB2	Ferric siderophore transport system energy transducer

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Irr in Bradyrhizobium japonicum USDA 110

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --