Regulon of Irr in Bartonella quintana str. Toulouse

Properties
Regulator type:	Transcription factor
TF locus tag:	BQ01230
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhizobiales
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 122 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhizobiales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -148 Score: 5.2 Sequence: GAATTAGAATTATTTTAAAAA Locus tag: BQ05950 Name: sufB Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: BQ05960 Name: sufC Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein Locus tag: BQ05970 Name: sufD Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: BQ05980 Name: sufS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily Locus tag: BQ05990 Name: PF01883 Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
	BQ05950	sufB	ABC transporter involved in Fe-S cluster assembly, permease protein
	BQ05960	sufC	ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
	BQ05970	sufD	ABC transporter involved in Fe-S cluster assembly, permease protein
	BQ05980	sufS1	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
	BQ05990	PF01883	PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Position: -36 Score: 6.1 Sequence: ATCTTAGAATTATTCTAAAGT Locus tag: BQ11660 Name: mbfA Funciton: membrane-bound ferritin
	BQ11660	mbfA	membrane-bound ferritin
Position: -98 Score: 5.2 Sequence: TTTCTAGAACTATTCTAGATA Locus tag: BQ01080 Name: ccmA Funciton: heme ABC transporter, ATPase subunit Locus tag: BQ01070 Name: ccmB Funciton: heme ABC transporter, permease subunit Locus tag: BQ01060 Name: ccmC Funciton: Cytochrome c-type biogenesis protein, heme lyase Locus tag: BQ01050 Name: ccmD Funciton: Cytochrome c-type biogenesis protein, interacts with CcmCE Locus tag: BQ01040 Name: ccmG Funciton: Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase
	BQ01080	ccmA	heme ABC transporter, ATPase subunit
	BQ01070	ccmB	heme ABC transporter, permease subunit
	BQ01060	ccmC	Cytochrome c-type biogenesis protein, heme lyase
	BQ01050	ccmD	Cytochrome c-type biogenesis protein, interacts with CcmCE
	BQ01040	ccmG	Cytochrome c-type biogenesis protein, thiol:disulfide oxidoreductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD