Regulon of Irr in Mesorhizobium sp. BNC1

Properties
Regulator type:	Transcription factor
TF locus tag:	Meso_3940
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhizobiales
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 122 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhizobiales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.4 Sequence: AGTTTAGAATTATTCTAATCA Locus tag: Meso_4072 Name: mbfA Funciton: membrane-bound ferritin
	Meso_4072	mbfA	membrane-bound ferritin
Position: -131 Score: 6.5 Sequence: AGTTTAGAACTGTTCAAAACT Locus tag: Meso_1782 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: Meso_1781 Name: sufB Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: Meso_1780 Name: sufC Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein Locus tag: Meso_1779 Name: sufD Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: Meso_1778 Name: sufS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily Locus tag: Meso_1777 Name: PF01883 Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly Locus tag: Meso_1776 Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
	Meso_1782	sufS2	Cysteine desulfurase (EC 2.8.1.7)
	Meso_1781	sufB	ABC transporter involved in Fe-S cluster assembly, permease protein
	Meso_1780	sufC	ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
	Meso_1779	sufD	ABC transporter involved in Fe-S cluster assembly, permease protein
	Meso_1778	sufS1	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
	Meso_1777	PF01883	PaaD-like protein (DUF59) involved in Fe-S cluster assembly
	Meso_1776	sufA	Iron binding protein SufA for iron-sulfur cluster assembly
Position: -143 Score: 6.9 Sequence: AGTTTAGAATAATTCTAAACT Locus tag: Meso_0170 Name: fbpA Funciton: Ferric iron ABC transporter, periplasmic protein Locus tag: Meso_0169 Name: fbpB Funciton: Ferric iron ABC transporter, permease protein
	Meso_0170	fbpA	Ferric iron ABC transporter, periplasmic protein
	Meso_0169	fbpB	Ferric iron ABC transporter, permease protein
Position: -44 Score: 6 Sequence: ATTTTAGAATTGTTCCAAAAA Locus tag: Meso_4037 Name: fssA Funciton: putative nifU-like iron-sulphur cluster scaffold protein
	Meso_4037	fssA	putative nifU-like iron-sulphur cluster scaffold protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD