Regulon of Irr in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH00106
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhizobiales
Statistics of regulated genes:
- Genes	14
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 122 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhizobiales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -206 Score: 6.6 Sequence: AGTTTAGAACAATTCGAAACT Locus tag: RHE_CH02254 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: RHE_CH02253 Name: sufB Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: RHE_CH02252 Name: PF01541 Funciton: Excinuclease ABC, C subunit-like Locus tag: RHE_CH02251 Name: sufC Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein Locus tag: RHE_CH02250 Name: sufD Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: RHE_CH02249 Name: sufS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily Locus tag: RHE_CH02248 Name: PF01883 Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly Locus tag: RHE_CH02247 Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
	RHE_CH02254	sufS2	Cysteine desulfurase (EC 2.8.1.7)
	RHE_CH02253	sufB	ABC transporter involved in Fe-S cluster assembly, permease protein
	RHE_CH02252	PF01541	Excinuclease ABC, C subunit-like
	RHE_CH02251	sufC	ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
	RHE_CH02250	sufD	ABC transporter involved in Fe-S cluster assembly, permease protein
	RHE_CH02249	sufS1	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
	RHE_CH02248	PF01883	PaaD-like protein (DUF59) involved in Fe-S cluster assembly
	RHE_CH02247	sufA	Iron binding protein SufA for iron-sulfur cluster assembly
Position: -99 Score: 5.6 Sequence: ATCTTAAAATTATTCCAAACT Locus tag: RHE_CH00304 Name: iprA Funciton: Iron-regulated protein A precursor
	RHE_CH00304	iprA	Iron-regulated protein A precursor
Position: -34 Score: 6.4 Sequence: GGTTTAGAATTATTCTAAATT Locus tag: RHE_CH00257 Name: mbfA Funciton: membrane-bound ferritin
	RHE_CH00257	mbfA	membrane-bound ferritin
Position: -69 Score: 6.1 Sequence: ATTTTGGAATTGTTCAAAACT Locus tag: RHE_CH00735 Name: rirA Funciton: Iron-responsive transcriptional regulator RirA, Rrf2 family
	RHE_CH00735	rirA	Iron-responsive transcriptional regulator RirA, Rrf2 family
Position: -118 Score: 5.2 Sequence: TGTCTGGAATCATTCAAAAAA Locus tag: RHE_CH03846 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	RHE_CH03846	hemA	5-aminolevulinate synthase (EC 2.3.1.37)
Position: -156 Score: 4.6 Sequence: CATTTAGATCGGTTCCAATTT Locus tag: RHE_CH02385 Name: fumA Funciton: Fumarate hydratase class I, aerobic (EC 4.2.1.2)
	RHE_CH02385	fumA	Fumarate hydratase class I, aerobic (EC 4.2.1.2)
Position: -57 Score: 5.4 Sequence: TCTTTTGAAGAATTCTAAAGA Locus tag: RHE_CH00381 Name: fssA Funciton: putative nifU-like iron-sulphur cluster scaffold protein
	RHE_CH00381	fssA	putative nifU-like iron-sulphur cluster scaffold protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Irr in Rhizobium etli CFN 42

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --