Regulon of LldR in Xanthobacter autotrophicus Py2

Properties
Regulator type:	Transcription factor
TF locus tag:	Xaut_4351
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Lactate utilization
Effector:	L-lactate
Regulog:	LldR - Rhizobiales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - LldR
By TF family - GntR/Others
By effector - L-lactate
By pathway - Lactate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 5.6 Sequence: TCGGTAAAATACTTTGACCAT Locus tag: Xaut_4351 Name: lldR Funciton: Lactate-responsive regulator LldR, GntR family
	Xaut_4351	lldR	Lactate-responsive regulator LldR, GntR family
Position: -206 Score: 5.1 Sequence: ATGGTCAAAGTATTTTACCGA Locus tag: Xaut_4350 Name: lldP Funciton: L-lactate permease
	Xaut_4350	lldP	L-lactate permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD