Profile of regulator LldR in Rhizobiales
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Lactate utilization |
| Effector: | L-lactate |
| Regulog: | LldR - Rhizobiales |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - LldR
- By TF family - GntR/Others
- By effector - L-lactate
- By pathway - Lactate utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Xanthobacter autotrophicus Py2 | |||||
| Xaut_4350 | lldP | -206 | 5.1 | ATGGTCAAAGTATTTTACCGA | |
| Xaut_4351 | lldR | -129 | 5.6 | TCGGTAAAATACTTTGACCAT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |